Veuillez utiliser cette adresse pour citer ce document : http://dspace.univ-tlemcen.dz/handle/112/16649
Titre: GATA-3 design des cellules Th2 CD4+
Auteur(s): ZERROUK Hicham
Mots-clés: gène GATA-3, Th2, conception d’amorces, Primer-BLAST
Date de publication: 20-sep-2020
Résumé: Résumé Introduction : Les cellules Th2 sont cruciales dans les réponses immunitaires adaptatives aux infections dues aux parasites extracellulaires tels que les helminthes. Les Th2 sont également responsables du développement de certaines maladies inflammatoires asthmatiques et allergiques. Le GATA-3 est le facteur de transcription clé régulant la différenciation et le maintien de la production de cytokines Th2. Objectif : L’élaboration des séquences d’oligonucléotides qui serviront d’amorces à l’amplification du gène GATA3 par PCR. Matériel et méthodes : Nous avons réalisé une étude bio-informatique pour obtenir une amorce spécifique au gène GATA3. Pour cela on a cherché la séquence spécifique au gène GATA3 à l’aide de la base de données www.ensemble.org , puis on a utilisé l’outil PrimerBLAST fournie par NCBI pour concevoir l’amorce. Enfin, on a confirmé les résultats par une PCR in silico. Résultats : L’utilisation de l’outil Primer-BLAST a permis d’obtenir une amorce spécifique au gène GATA3 à savoir : F primer CCCCAATGCTCCCAAAAGTC, R primer GGGCGATGTACGTTCTTCCT avec un produit spécifique de 367 pb , Tm (F primer : 59,39 °C, R primer : 59,82 °C), la teneur en GC est de 55 % pour l’amorce sens et anti sens et une longueur de 20 nucléotides pour les deux amorces. Conclusions : L’utilisation des outils de la bioinformatique, tel que l’outil de conception d’amorces (Primer-Blast), nous a permis d'établir des amorces PCR pouvant être utilisés aux protocoles expérimentaux dans les laboratoires de recherche et de diagnostic. Mots clé : gène GATA-3, Th2, conception d’amorces, Primer-BLAST
URI/URL: http://dspace.univ-tlemcen.dz/handle/112/16649
Collection(s) :Master en Biologie

Fichier(s) constituant ce document :
Fichier Description TailleFormat 
ZERROUK.pdf1,96 MBAdobe PDFVoir/Ouvrir


Tous les documents dans DSpace sont protégés par copyright, avec tous droits réservés.